Transcript: Human NM_006269.2

Homo sapiens RP1 axonemal microtubule associated (RP1), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
RP1 (6101)
Length:
7071
CDS:
120..6590

Additional Resources:

NCBI RefSeq record:
NM_006269.2
NBCI Gene record:
RP1 (6101)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084129 GCCCAATACTAACTGTTATTA pLKO.1 5872 CDS 100% 15.000 21.000 N RP1 n/a
2 TRCN0000084131 GCCATTCAAGTAGATCCTATA pLKO.1 3321 CDS 100% 10.800 15.120 N RP1 n/a
3 TRCN0000084130 CGGCACTATGACAGTTGAGAT pLKO.1 1103 CDS 100% 4.950 6.930 N RP1 n/a
4 TRCN0000084132 CCTGAGGCTATTGCTCATCAT pLKO.1 2829 CDS 100% 4.950 3.465 N RP1 n/a
5 TRCN0000084128 GCACACTCATTCTTTGTCAAT pLKO.1 6602 3UTR 100% 4.950 3.465 N RP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.