Transcript: Human NM_006297.2

Homo sapiens X-ray repair cross complementing 1 (XRCC1), mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XRCC1 (7515)
Length:
2102
CDS:
121..2022

Additional Resources:

NCBI RefSeq record:
NM_006297.2
NBCI Gene record:
XRCC1 (7515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006297.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011211 CGATACGTCACAGCCTTCAAT pLKO.1 1810 CDS 100% 5.625 7.875 N XRCC1 n/a
2 TRCN0000273634 CGATACGTCACAGCCTTCAAT pLKO_005 1810 CDS 100% 5.625 7.875 N XRCC1 n/a
3 TRCN0000011210 CGATGGATCTACAGTTGCAAT pLKO.1 1948 CDS 100% 4.950 6.930 N XRCC1 n/a
4 TRCN0000007913 CCAGTGCTCCAGGAAGATATA pLKO.1 1504 CDS 100% 13.200 9.240 N XRCC1 n/a
5 TRCN0000285033 CCAGTGCTCCAGGAAGATATA pLKO_005 1504 CDS 100% 13.200 9.240 N XRCC1 n/a
6 TRCN0000273635 AGTCAGAAGGACAGGACAATG pLKO_005 1541 CDS 100% 10.800 7.560 N XRCC1 n/a
7 TRCN0000273633 TCCAGGGCAAGCACTTCTTTC pLKO_005 1748 CDS 100% 10.800 7.560 N XRCC1 n/a
8 TRCN0000007912 CCTTCTGGTCACCTCATCTTT pLKO.1 378 CDS 100% 5.625 3.938 N XRCC1 n/a
9 TRCN0000007914 GACCTAAATTGCCAGCTCCAA pLKO.1 935 CDS 100% 2.640 1.584 N XRCC1 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2036 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006297.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.