Transcript: Human NM_006391.3

Homo sapiens importin 7 (IPO7), mRNA.

Source:
NCBI, updated 2019-06-09
Taxon:
Homo sapiens (human)
Gene:
IPO7 (10527)
Length:
6162
CDS:
113..3229

Additional Resources:

NCBI RefSeq record:
NM_006391.3
NBCI Gene record:
IPO7 (10527)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150676 GCTAACAAGAAGATGTCTGAT pLKO.1 1609 CDS 100% 4.950 6.930 N IPO7 n/a
2 TRCN0000343866 GCTAACAAGAAGATGTCTGAT pLKO_005 1609 CDS 100% 4.950 6.930 N IPO7 n/a
3 TRCN0000156994 GCACTGACTCACGGTCTTAAT pLKO.1 3047 CDS 100% 13.200 9.240 N IPO7 n/a
4 TRCN0000343867 GCACTGACTCACGGTCTTAAT pLKO_005 3047 CDS 100% 13.200 9.240 N IPO7 n/a
5 TRCN0000155123 CCCTGTTGATGAGTATCAGAT pLKO.1 2974 CDS 100% 4.950 3.465 N IPO7 n/a
6 TRCN0000150736 GATGAAGATAACCCTGTTGAT pLKO.1 2963 CDS 100% 4.950 3.465 N IPO7 n/a
7 TRCN0000151374 GCAGTAGAAATGACACAACAT pLKO.1 1841 CDS 100% 4.950 3.465 N IPO7 n/a
8 TRCN0000154944 GTTCCAGAACTGGTTCATGTT pLKO.1 3291 3UTR 100% 4.950 3.465 N IPO7 n/a
9 TRCN0000155501 CAGAACCTTCAAACAGCCTTA pLKO.1 1586 CDS 100% 4.050 2.835 N IPO7 n/a
10 TRCN0000343928 CAGAACCTTCAAACAGCCTTA pLKO_005 1586 CDS 100% 4.050 2.835 N IPO7 n/a
11 TRCN0000156655 GAAGAGCTTGTGTTCCTCCTA pLKO.1 3264 3UTR 100% 2.640 1.848 N IPO7 n/a
12 TRCN0000343868 GAAGAGCTTGTGTTCCTCCTA pLKO_005 3264 3UTR 100% 2.640 1.848 N IPO7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006391.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.