Transcript: Human NM_006401.3

Homo sapiens acidic nuclear phosphoprotein 32 family member B (ANP32B), mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
ANP32B (10541)
Length:
1483
CDS:
216..971

Additional Resources:

NCBI RefSeq record:
NM_006401.3
NBCI Gene record:
ANP32B (10541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077929 GCTTACCTACTTGGATGGCTA pLKO.1 638 CDS 100% 2.640 3.696 N ANP32B n/a
2 TRCN0000289134 GCTTACCTACTTGGATGGCTA pLKO_005 638 CDS 100% 2.640 3.696 N ANP32B n/a
3 TRCN0000077931 GAGGGCTTAACAGCTGAATTT pLKO.1 318 CDS 100% 13.200 9.240 N ANP32B n/a
4 TRCN0000289135 GAGGGCTTAACAGCTGAATTT pLKO_005 318 CDS 100% 13.200 9.240 N ANP32B n/a
5 TRCN0000077930 CTTGGACAATTGCAAATCAAA pLKO.1 284 CDS 100% 5.625 3.938 N ANP32B n/a
6 TRCN0000077177 CTTGTCTTGGACAATTGCAAA pLKO.1 279 CDS 100% 4.950 3.465 N Anp32b n/a
7 TRCN0000333882 CTTGTCTTGGACAATTGCAAA pLKO_005 279 CDS 100% 4.950 3.465 N Anp32b n/a
8 TRCN0000077928 CCACCCAAAGAGCCAAAGAAT pLKO.1 1089 3UTR 100% 5.625 3.375 N ANP32B n/a
9 TRCN0000307043 CCACCCAAAGAGCCAAAGAAT pLKO_005 1089 3UTR 100% 5.625 3.375 N ANP32B n/a
10 TRCN0000077932 GAAGAATTTGGACTTGATGAA pLKO.1 855 CDS 100% 4.950 2.970 N ANP32B n/a
11 TRCN0000289133 GAAGAATTTGGACTTGATGAA pLKO_005 855 CDS 100% 4.950 2.970 N ANP32B n/a
12 TRCN0000153022 GATGAGGATGAGGATGAAGAT pLKO.1 885 CDS 100% 4.950 2.475 Y OS9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006401.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.