Transcript: Human NM_006420.3

Homo sapiens ADP ribosylation factor guanine nucleotide exchange factor 2 (ARFGEF2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ARFGEF2 (10564)
Length:
9031
CDS:
180..5537

Additional Resources:

NCBI RefSeq record:
NM_006420.3
NBCI Gene record:
ARFGEF2 (10564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006420.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251882 CATTGAAGCTGACAAGTATTT pLKO_005 365 CDS 100% 13.200 9.240 N Arfgef2 n/a
2 TRCN0000047315 CGACACCATTAAGACGCTTAT pLKO.1 3083 CDS 100% 10.800 7.560 N ARFGEF2 n/a
3 TRCN0000047314 CGCCAGTCTTTAAGCAGCATA pLKO.1 4704 CDS 100% 4.950 3.465 N ARFGEF2 n/a
4 TRCN0000047316 CCATTAAAGAAGCAGCGGAAA pLKO.1 1078 CDS 100% 4.050 2.835 N ARFGEF2 n/a
5 TRCN0000047317 CCCTGAGCAATTTGAGGTCAT pLKO.1 2078 CDS 100% 4.050 2.835 N ARFGEF2 n/a
6 TRCN0000047313 GCTTCATTTCTATCATTCCAT pLKO.1 5763 3UTR 100% 3.000 2.100 N ARFGEF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006420.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.