Transcript: Human NM_006487.3

Homo sapiens fibulin 1 (FBLN1), transcript variant A, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
FBLN1 (2192)
Length:
2442
CDS:
104..1804

Additional Resources:

NCBI RefSeq record:
NM_006487.3
NBCI Gene record:
FBLN1 (2192)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006487.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055676 CGAATGCAAGACGGGTTACTA pLKO.1 1249 CDS 100% 5.625 7.875 N FBLN1 n/a
2 TRCN0000306749 CGAATGCAAGACGGGTTACTA pLKO_005 1249 CDS 100% 5.625 7.875 N FBLN1 n/a
3 TRCN0000055675 CCTCCAAGAAACGGATAAGAT pLKO.1 574 CDS 100% 5.625 3.938 N FBLN1 n/a
4 TRCN0000289375 CCTCCAAGAAACGGATAAGAT pLKO_005 574 CDS 100% 5.625 3.938 N FBLN1 n/a
5 TRCN0000055673 CCTGTGAAGATGTCAATGAAT pLKO.1 741 CDS 100% 5.625 3.938 N FBLN1 n/a
6 TRCN0000289437 CCTGTGAAGATGTCAATGAAT pLKO_005 741 CDS 100% 5.625 3.938 N FBLN1 n/a
7 TRCN0000055677 GCTTGGAGAATCCTGCATCAA pLKO.1 787 CDS 100% 4.950 3.465 N FBLN1 n/a
8 TRCN0000306750 GCTTGGAGAATCCTGCATCAA pLKO_005 787 CDS 100% 4.950 3.465 N FBLN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006487.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.