Transcript: Human NM_006514.3

Homo sapiens sodium voltage-gated channel alpha subunit 10 (SCN10A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
SCN10A (6336)
Length:
5874
CDS:
1..5871

Additional Resources:

NCBI RefSeq record:
NM_006514.3
NBCI Gene record:
SCN10A (6336)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006514.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431751 CCTTCGACCCATACTATTATT pLKO_005 2153 CDS 100% 15.000 21.000 N SCN10A n/a
2 TRCN0000415398 AGATAGGCAACATCGTCTTTA pLKO_005 2093 CDS 100% 13.200 18.480 N SCN10A n/a
3 TRCN0000044529 CCCACAATGGATCACCTTTAA pLKO.1 1331 CDS 100% 13.200 18.480 N SCN10A n/a
4 TRCN0000044532 GCAATGGGTTACCTTGCACTT pLKO.1 4060 CDS 100% 4.050 5.670 N SCN10A n/a
5 TRCN0000044528 CGCCCTGCTATTGAACTCTTT pLKO.1 2658 CDS 100% 4.950 3.960 N SCN10A n/a
6 TRCN0000434752 TGCGGGCTCTTTCTCGATTTG pLKO_005 3773 CDS 100% 10.800 7.560 N SCN10A n/a
7 TRCN0000044530 GCTGTTGCTATTCCTTGTCAT pLKO.1 4833 CDS 100% 4.950 3.465 N SCN10A n/a
8 TRCN0000044531 CCAGAAGAAGTGGAATATCTT pLKO.1 2175 CDS 100% 5.625 3.375 N SCN10A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006514.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.