Transcript: Human NM_006517.5

Homo sapiens solute carrier family 16 member 2 (SLC16A2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SLC16A2 (6567)
Length:
4128
CDS:
146..1765

Additional Resources:

NCBI RefSeq record:
NM_006517.5
NBCI Gene record:
SLC16A2 (6567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006517.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038370 CGCGATGGGTATGATCTTCTT pLKO.1 592 CDS 100% 4.950 6.930 N SLC16A2 n/a
2 TRCN0000038373 GAGTATATTCACTGACCGTTT pLKO.1 628 CDS 100% 4.050 5.670 N SLC16A2 n/a
3 TRCN0000038371 CCTACGGGATTCTCTTTGGTT pLKO.1 744 CDS 100% 3.000 4.200 N SLC16A2 n/a
4 TRCN0000038369 CCCTGGACTTAAGAAGATCTA pLKO.1 1288 CDS 100% 4.950 3.465 N SLC16A2 n/a
5 TRCN0000038372 CTTGGCTACTTTGTTCCCTAT pLKO.1 1142 CDS 100% 4.050 2.835 N SLC16A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006517.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.