Transcript: Human NM_006567.5

Homo sapiens phenylalanyl-tRNA synthetase 2, mitochondrial (FARS2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
FARS2 (10667)
Length:
1679
CDS:
170..1525

Additional Resources:

NCBI RefSeq record:
NM_006567.5
NBCI Gene record:
FARS2 (10667)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006567.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230543 AGTTCTCGCTCTGCGCATAAA pLKO_005 830 CDS 100% 13.200 18.480 N FARS2 n/a
2 TRCN0000230544 TCCGGCTGTGATCAATGATAT pLKO_005 1249 CDS 100% 13.200 18.480 N FARS2 n/a
3 TRCN0000045734 GCCGTGAAGCTTGTAGAGTTT pLKO.1 872 CDS 100% 4.950 6.930 N FARS2 n/a
4 TRCN0000230541 ACTCCCAGCACTACCCTATTT pLKO_005 720 CDS 100% 13.200 9.240 N FARS2 n/a
5 TRCN0000230542 GAGTTATTTGCTGGTATAAAG pLKO_005 779 CDS 100% 13.200 9.240 N FARS2 n/a
6 TRCN0000217976 TGGAACAACAACTGGTCAATT pLKO_005 1050 CDS 100% 13.200 9.240 N FARS2 n/a
7 TRCN0000045737 AGGTGAAGTTTCAGCCTCTTA pLKO.1 1221 CDS 100% 4.950 3.465 N FARS2 n/a
8 TRCN0000045733 CCTCTGAGAATTACGCAGAAA pLKO.1 1284 CDS 100% 4.950 3.465 N FARS2 n/a
9 TRCN0000045735 GAGCACTTCTACAAGCAGTAT pLKO.1 452 CDS 100% 4.950 3.465 N FARS2 n/a
10 TRCN0000045736 GCATGAGTTATTTGCTGGTAT pLKO.1 775 CDS 100% 4.950 3.465 N FARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006567.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.