Transcript: Human NM_006642.5

Homo sapiens serologically defined colon cancer antigen 8 (SDCCAG8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
SDCCAG8 (10806)
Length:
2581
CDS:
134..2275

Additional Resources:

NCBI RefSeq record:
NM_006642.5
NBCI Gene record:
SDCCAG8 (10806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006642.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435650 ACGACCTTGTTCATACTATTA pLKO_005 480 CDS 100% 13.200 18.480 N SDCCAG8 n/a
2 TRCN0000128868 GAGGAACGACTTAGCTGAATA pLKO.1 871 CDS 100% 13.200 18.480 N SDCCAG8 n/a
3 TRCN0000128258 GAAATAGCTCAACTCAGTCAA pLKO.1 1991 CDS 100% 4.950 6.930 N SDCCAG8 n/a
4 TRCN0000421956 CTTTCCCAAACCCATACTAAT pLKO_005 1010 CDS 100% 13.200 9.240 N SDCCAG8 n/a
5 TRCN0000130059 GCTGTTAATCAGCTCAAAGAT pLKO.1 350 CDS 100% 5.625 3.938 N SDCCAG8 n/a
6 TRCN0000130350 GAGCTTTAGCAAGGAAGCAAA pLKO.1 1774 CDS 100% 4.950 3.465 N SDCCAG8 n/a
7 TRCN0000130332 GATAGCATTCAGCAGAGCTTT pLKO.1 1760 CDS 100% 4.950 3.465 N SDCCAG8 n/a
8 TRCN0000127683 GCACAGAGAGTTCAGAGCAAA pLKO.1 1555 CDS 100% 4.950 3.465 N SDCCAG8 n/a
9 TRCN0000415404 AGAGATATTTACATTCATCTG pLKO_005 2311 3UTR 100% 4.050 2.835 N SDCCAG8 n/a
10 TRCN0000127833 GCAGAAGCATTCACCAACTGA pLKO.1 210 CDS 100% 3.000 2.100 N SDCCAG8 n/a
11 TRCN0000128257 GCTATTAATCAACTGGAGGAA pLKO.1 1427 CDS 100% 2.640 1.848 N SDCCAG8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006642.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.