Transcript: Human NM_006676.7

Homo sapiens ubiquitin specific peptidase 20 (USP20), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
USP20 (10868)
Length:
4538
CDS:
212..2956

Additional Resources:

NCBI RefSeq record:
NM_006676.7
NBCI Gene record:
USP20 (10868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006676.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273309 GATCCTGTGCATTCACCTAAA pLKO_005 1951 CDS 100% 10.800 15.120 N USP20 n/a
2 TRCN0000007609 GCGACCATCATCAGGATCAAA pLKO.1 4135 3UTR 100% 5.625 7.875 N USP20 n/a
3 TRCN0000273249 GCGACCATCATCAGGATCAAA pLKO_005 4135 3UTR 100% 5.625 7.875 N USP20 n/a
4 TRCN0000007612 GACATCTTTGACGGCTCCATT pLKO.1 1550 CDS 100% 4.950 6.930 N USP20 n/a
5 TRCN0000007613 CGCCTGTGAGAAGGAGGTATT pLKO.1 463 CDS 100% 10.800 8.640 N USP20 n/a
6 TRCN0000007611 CGACACCTTCATCAAGTTGAA pLKO.1 2605 CDS 100% 4.950 3.960 N USP20 n/a
7 TRCN0000273248 CGACACCTTCATCAAGTTGAA pLKO_005 2605 CDS 100% 4.950 3.960 N USP20 n/a
8 TRCN0000273247 ATGGGCAGTGGTACGAGTTTG pLKO_005 2169 CDS 100% 10.800 7.560 N USP20 n/a
9 TRCN0000273308 CTATGTTGGCTGCGGAGAATC pLKO_005 358 CDS 100% 10.800 7.560 N USP20 n/a
10 TRCN0000007610 CCCATTGACAACAGCAGGATT pLKO.1 2735 CDS 100% 4.950 3.465 N USP20 n/a
11 TRCN0000037243 CCTATTGCTGTGGCTGATGAA pLKO.1 578 CDS 100% 4.950 3.465 N Usp20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006676.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.