Transcript: Human NM_006690.4

Homo sapiens matrix metallopeptidase 24 (MMP24), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MMP24 (10893)
Length:
4376
CDS:
50..1987

Additional Resources:

NCBI RefSeq record:
NM_006690.4
NBCI Gene record:
MMP24 (10893)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006690.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052243 CCTACAGCATTCACAACTATA pLKO.1 555 CDS 100% 13.200 18.480 N MMP24 n/a
2 TRCN0000437220 GTTCTGGCGTCTGCGCAATAA pLKO_005 1252 CDS 100% 13.200 18.480 N MMP24 n/a
3 TRCN0000419421 GGCAAACTACTCCCTACTTAA pLKO_005 2216 3UTR 100% 13.200 9.240 N MMP24 n/a
4 TRCN0000052246 AGGAAGGATATTACACCTATT pLKO.1 1641 CDS 100% 10.800 7.560 N MMP24 n/a
5 TRCN0000221966 GTGCCATACCATGAGATCAAA pLKO.1 665 CDS 100% 5.625 3.938 N Mmp24 n/a
6 TRCN0000437964 AGCTGAAGTGGTGGGTGCATT pLKO_005 2109 3UTR 100% 4.950 3.465 N MMP24 n/a
7 TRCN0000052244 CGATGGGAGATTTGTCTTCTT pLKO.1 1357 CDS 100% 4.950 3.465 N MMP24 n/a
8 TRCN0000437667 AGAGCCCTCTCTATCCACTTG pLKO_005 1995 3UTR 100% 4.050 2.835 N MMP24 n/a
9 TRCN0000052245 CTGGTTAAAGTCCTATGGCTA pLKO.1 298 CDS 100% 2.640 1.848 N MMP24 n/a
10 TRCN0000052247 CCTCAGCCTGTCACCTACTAT pLKO.1 1940 CDS 100% 5.625 3.375 N MMP24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006690.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.