Transcript: Human NM_006747.4

Homo sapiens signal-induced proliferation-associated 1 (SIPA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SIPA1 (6494)
Length:
3499
CDS:
174..3302

Additional Resources:

NCBI RefSeq record:
NM_006747.4
NBCI Gene record:
SIPA1 (6494)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006747.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162813 CGACATTGTGACCATCGTGTT pLKO.1 1463 CDS 100% 4.050 5.670 N SIPA1 n/a
2 TRCN0000163514 GTAGTGTTCAATTGCGCCTGT pLKO.1 2055 CDS 100% 2.160 3.024 N SIPA1 n/a
3 TRCN0000158443 CTATGGCAAAGAACATCAGAA pLKO.1 842 CDS 100% 4.950 3.465 N SIPA1 n/a
4 TRCN0000163603 CTCAGAGAAGGTCTCTCACTT pLKO.1 3095 CDS 100% 4.950 3.465 N SIPA1 n/a
5 TRCN0000163259 GAACTCCATCAGCAGGATCAT pLKO.1 2903 CDS 100% 4.950 3.465 N SIPA1 n/a
6 TRCN0000159066 GCAAAGAACATCAGAACTTCT pLKO.1 847 CDS 100% 4.950 3.465 N SIPA1 n/a
7 TRCN0000159970 CGCAAATACTTCTATGGCAAA pLKO.1 831 CDS 100% 4.050 2.835 N SIPA1 n/a
8 TRCN0000164274 CATTGTGACCATCGTGTTCCA pLKO.1 1466 CDS 100% 2.640 1.848 N SIPA1 n/a
9 TRCN0000159568 CAAAGAACATCAGAACTTCTT pLKO.1 848 CDS 100% 0.495 0.347 N SIPA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006747.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.