Transcript: Human NM_006841.6

Homo sapiens solute carrier family 38 member 3 (SLC38A3), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SLC38A3 (10991)
Length:
2953
CDS:
130..1644

Additional Resources:

NCBI RefSeq record:
NM_006841.6
NBCI Gene record:
SLC38A3 (10991)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006841.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007641 GAACGGGAACTACCTGGTAAT pLKO.1 690 CDS 100% 10.800 15.120 N SLC38A3 n/a
2 TRCN0000007639 CGCGATTAACACTGTGGCATT pLKO.1 1743 3UTR 100% 4.050 5.670 N SLC38A3 n/a
3 TRCN0000007642 GCCACTTGTCATACAGACCTT pLKO.1 633 CDS 100% 2.640 3.696 N SLC38A3 n/a
4 TRCN0000007643 GCTCACTTGTATCAACCTGCT pLKO.1 1371 CDS 100% 2.160 3.024 N SLC38A3 n/a
5 TRCN0000436551 GCATGGTGTTCTTCCTAATTG pLKO_005 797 CDS 100% 13.200 10.560 N SLC38A3 n/a
6 TRCN0000431233 ACACAGCCTGTAGGAACATAC pLKO_005 1973 3UTR 100% 10.800 7.560 N SLC38A3 n/a
7 TRCN0000419198 GCCATCTTCTACTTCCGAATC pLKO_005 1474 CDS 100% 6.000 4.200 N SLC38A3 n/a
8 TRCN0000007640 CGCTGTCATGTACATCATGTA pLKO.1 1107 CDS 100% 4.950 3.465 N SLC38A3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006841.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.