Transcript: Human NM_006850.3

Homo sapiens interleukin 24 (IL24), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
IL24 (11009)
Length:
1976
CDS:
276..896

Additional Resources:

NCBI RefSeq record:
NM_006850.3
NBCI Gene record:
IL24 (11009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058444 GCATTCAAACAGTTGGACGTA pLKO.1 801 CDS 100% 2.640 3.696 N IL24 n/a
2 TRCN0000058446 CAGGGCCAAGAATTCCACTTT pLKO.1 423 CDS 100% 0.000 0.000 N IL24 n/a
3 TRCN0000378744 CACAGGCGGTTTCTGCTATTC pLKO_005 774 CDS 100% 10.800 7.560 N IL24 n/a
4 TRCN0000372643 GTCAGGACTCTGAAGTCATTC pLKO_005 666 CDS 100% 10.800 7.560 N IL24 n/a
5 TRCN0000378743 TCGGATGCTGAGAGCTGTTAC pLKO_005 576 CDS 100% 10.800 7.560 N IL24 n/a
6 TRCN0000058447 GACCTGGATGCAGAAATTCTA pLKO.1 866 CDS 100% 5.625 3.938 N IL24 n/a
7 TRCN0000058445 CCTGCTGGAGTTCTACTTGAA pLKO.1 608 CDS 100% 4.950 3.465 N IL24 n/a
8 TRCN0000058443 GCTGTGAAAGACACTATGCAA pLKO.1 498 CDS 100% 3.000 2.100 N IL24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006850.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.