Transcript: Human NM_006892.4

Homo sapiens DNA methyltransferase 3 beta (DNMT3B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
DNMT3B (1789)
Length:
4336
CDS:
322..2883

Additional Resources:

NCBI RefSeq record:
NM_006892.4
NBCI Gene record:
DNMT3B (1789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006892.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364152 AGCTGTCCGAACTCGAAATAA pLKO_005 624 CDS 100% 15.000 21.000 N DNMT3B n/a
2 TRCN0000414235 AGCCTAACACGGTGCTCATTT pLKO_005 3105 3UTR 100% 13.200 18.480 N DNMT3B n/a
3 TRCN0000424360 GACGATGGCTATCAGTCTTAC pLKO_005 1732 CDS 100% 10.800 15.120 N DNMT3B n/a
4 TRCN0000035684 GCCTCAAGACAAATTGCTATA pLKO.1 1514 CDS 100% 10.800 15.120 N DNMT3B n/a
5 TRCN0000035685 GCCCGTGATAGCATCAAAGAA pLKO.1 2553 CDS 100% 5.625 7.875 N DNMT3B n/a
6 TRCN0000378379 ACACGCAACCAGTGGTTAATA pLKO_005 1376 CDS 100% 15.000 12.000 N DNMT3B n/a
7 TRCN0000419070 TCACGGTTCCTGGAGTGTAAT pLKO_005 2452 CDS 100% 13.200 10.560 N DNMT3B n/a
8 TRCN0000364153 CAATAGGATAGCCAAGTTAAA pLKO_005 2607 CDS 100% 13.200 9.240 N DNMT3B n/a
9 TRCN0000035686 CCATGCAACGATCTCTCAAAT pLKO.1 2269 CDS 100% 13.200 9.240 N DNMT3B n/a
10 TRCN0000437183 AGTGCCGACAGCTCTCCAATA pLKO_005 3235 3UTR 100% 10.800 7.560 N DNMT3B n/a
11 TRCN0000035687 GCAGGCAGTAGGAAATTAGAA pLKO.1 1414 CDS 100% 5.625 3.938 N DNMT3B n/a
12 TRCN0000418133 AGTAGGTAGCAACGTGGCTTT pLKO_005 3154 3UTR 100% 4.050 2.835 N DNMT3B n/a
13 TRCN0000035688 CCTGTCATTGTTTGATGGCAT pLKO.1 2052 CDS 100% 2.640 1.848 N DNMT3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006892.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.