Transcript: Human NM_006896.4

Homo sapiens homeobox A7 (HOXA7), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
HOXA7 (3204)
Length:
2016
CDS:
131..823

Additional Resources:

NCBI RefSeq record:
NM_006896.4
NBCI Gene record:
HOXA7 (3204)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006896.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015086 CCTCGACCGTTCCGGGCTTAT pLKO.1 273 CDS 100% 0.000 0.000 N HOXA7 n/a
2 TRCN0000012506 CGAGCCGACTTCTTGCTCCTT pLKO.1 202 CDS 100% 0.880 0.704 N Hoxa7 n/a
3 TRCN0000416445 AGACCCGCAAGAAAGTGAATC pLKO_005 1251 3UTR 100% 10.800 7.560 N HOXA7 n/a
4 TRCN0000012503 GAAGTGGAAGAAAGAGCATAA pLKO.1 679 CDS 100% 10.800 7.560 N Hoxa7 n/a
5 TRCN0000360355 AGCCGACTTCTTGCTCCTTTG pLKO_005 204 CDS 100% 6.000 4.200 N Hoxa7 n/a
6 TRCN0000433612 AGCCGACTTCTTGCTCCTTTG pLKO_005 204 CDS 100% 6.000 4.200 N HOXA7 n/a
7 TRCN0000015083 CTTTAAGAGACTCACTGGTTT pLKO.1 870 3UTR 100% 4.950 3.465 N HOXA7 n/a
8 TRCN0000015084 TCCGGGCTTATACAATGTCAA pLKO.1 283 CDS 100% 4.950 3.465 N HOXA7 n/a
9 TRCN0000015085 GTGGAAGAAAGAGCATAAGGA pLKO.1 682 CDS 100% 3.000 2.100 N HOXA7 n/a
10 TRCN0000015087 GATGCGGTCTTCAGGACCTGA pLKO.1 496 CDS 100% 0.880 0.616 N HOXA7 n/a
11 TRCN0000012504 CGGGCTTATACAATGTCAACA pLKO.1 285 CDS 100% 4.950 2.970 N Hoxa7 n/a
12 TRCN0000225923 CGGGCTTATACAATGTCAACA pLKO_005 285 CDS 100% 4.950 2.970 N Hoxa7 n/a
13 TRCN0000218002 AGTGGAAGAAAGAGCATAAAG pLKO_005 681 CDS 100% 13.200 9.240 N Hoxa7 n/a
14 TRCN0000240652 TCTGGTTCCAGAACCGCCGAA pLKO_005 657 CDS 100% 0.720 0.360 Y Nkx1-1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006896.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.