Transcript: Human NM_006933.7

Homo sapiens solute carrier family 5 member 3 (SLC5A3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SLC5A3 (6526)
Length:
11566
CDS:
505..2661

Additional Resources:

NCBI RefSeq record:
NM_006933.7
NBCI Gene record:
SLC5A3 (6526)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006933.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256902 AGAAGAGACTCGGCAAGTTAA pLKO_005 2568 CDS 100% 13.200 18.480 N SLC5A3 n/a
2 TRCN0000256898 CCTCGATGTGTACAAACTTAT pLKO_005 1677 CDS 100% 13.200 18.480 N SLC5A3 n/a
3 TRCN0000256899 ACATCATTCCCAACGGGAAAT pLKO_005 2255 CDS 100% 10.800 15.120 N SLC5A3 n/a
4 TRCN0000256897 GAATACTTGTCCAAGCGATTT pLKO_005 835 CDS 100% 10.800 15.120 N SLC5A3 n/a
5 TRCN0000256901 GACTAATTCTGAAGCATATTT pLKO_005 9501 3UTR 100% 15.000 12.000 N SLC5A3 n/a
6 TRCN0000042908 GCCATAGGATTCAGGTCTATT pLKO.1 860 CDS 100% 13.200 10.560 N SLC5A3 n/a
7 TRCN0000267653 GAGGATATTTGTGGCATTTAT pLKO_005 1737 CDS 100% 15.000 10.500 N SLC5A3 n/a
8 TRCN0000256896 GCACTTACACTTATGATTATT pLKO_005 1090 CDS 100% 15.000 10.500 N SLC5A3 n/a
9 TRCN0000267658 CCGATGTCACTTCCATCTTAT pLKO_005 1169 CDS 100% 13.200 9.240 N SLC5A3 n/a
10 TRCN0000256900 TTGCCATAGTGGCCCTGTATT pLKO_005 533 CDS 100% 13.200 9.240 N SLC5A3 n/a
11 TRCN0000042911 CCTCTCTGTTTGTGAGCAATA pLKO.1 662 CDS 100% 10.800 7.560 N SLC5A3 n/a
12 TRCN0000042910 GCCTGAAGATGTTAATCTGTT pLKO.1 2301 CDS 100% 4.950 3.465 N SLC5A3 n/a
13 TRCN0000042912 GCTTCATCAAAGACATCCATT pLKO.1 2015 CDS 100% 4.950 3.465 N SLC5A3 n/a
14 TRCN0000256895 ACCCTAACCATTGGCATATAT pLKO_005 7772 3UTR 100% 15.000 9.000 N SLC5A3 n/a
15 TRCN0000042909 GCAGCTCTGATGAGTGACTTA pLKO.1 1621 CDS 100% 4.950 2.970 N SLC5A3 n/a
16 TRCN0000070089 CCTGGATTCATTCTTGGGCAA pLKO.1 1288 CDS 100% 2.160 1.512 N Slc5a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006933.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.