Transcript: Human NM_006950.3

Homo sapiens synapsin I (SYN1), transcript variant Ia, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SYN1 (6853)
Length:
3210
CDS:
130..2247

Additional Resources:

NCBI RefSeq record:
NM_006950.3
NBCI Gene record:
SYN1 (6853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148890 CAATCTGCCAAATGGGTACAT pLKO.1 174 CDS 100% 4.950 6.930 N SYN1 n/a
2 TRCN0000147000 CTTGCATTCTGTCTACAACTT pLKO.1 774 CDS 100% 4.950 6.930 N SYN1 n/a
3 TRCN0000148052 GATATGGAAGTTCTTCGGAAT pLKO.1 619 CDS 100% 4.050 5.670 N SYN1 n/a
4 TRCN0000146544 GAAGACAAACAGCTCATCGTA pLKO.1 1330 CDS 100% 3.000 2.100 N SYN1 n/a
5 TRCN0000147033 CCAATCACAAAGAAATGCTCA pLKO.1 887 CDS 100% 2.640 1.848 N SYN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.