Transcript: Human NM_007037.6

Homo sapiens ADAM metallopeptidase with thrombospondin type 1 motif 8 (ADAMTS8), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ADAMTS8 (11095)
Length:
3628
CDS:
324..2993

Additional Resources:

NCBI RefSeq record:
NM_007037.6
NBCI Gene record:
ADAMTS8 (11095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007037.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051033 CCCACCAATTATGGCTACAAT pLKO.1 2415 CDS 100% 5.625 7.875 N ADAMTS8 n/a
2 TRCN0000427351 GAGTAGGACCAAGCGGTTTGT pLKO_005 947 CDS 100% 4.950 6.930 N ADAMTS8 n/a
3 TRCN0000051034 GTTCCTAATGACGTGGACTTT pLKO.1 2745 CDS 100% 4.950 6.930 N ADAMTS8 n/a
4 TRCN0000429936 GCAAAGGACTAGCAAACTTAA pLKO_005 3303 3UTR 100% 13.200 9.240 N ADAMTS8 n/a
5 TRCN0000418342 ACACTGACATGGACGGGAATC pLKO_005 2122 CDS 100% 6.000 4.200 N ADAMTS8 n/a
6 TRCN0000051035 CAGAACCACATCCTGACGTTA pLKO.1 1041 CDS 100% 4.950 3.465 N ADAMTS8 n/a
7 TRCN0000051036 GCAGCAGTGTGAGAAGTATAA pLKO.1 2090 CDS 100% 13.200 7.920 N ADAMTS8 n/a
8 TRCN0000051037 ACCTGCAACAAGGCTCTGAAA pLKO.1 2928 CDS 100% 4.950 2.970 N ADAMTS8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007037.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.