Transcript: Human NM_007041.4

Homo sapiens arginyltransferase 1 (ATE1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ATE1 (11101)
Length:
4895
CDS:
83..1639

Additional Resources:

NCBI RefSeq record:
NM_007041.4
NBCI Gene record:
ATE1 (11101)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007041.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034669 CGGGTGACTTTGCATTGATAA pLKO.1 456 CDS 100% 13.200 18.480 N ATE1 n/a
2 TRCN0000034673 CACAATAAGGTGCCGACCTTT pLKO.1 307 CDS 100% 0.495 0.693 N ATE1 n/a
3 TRCN0000435957 TGTACTACGATCCTGATTATT pLKO_005 1185 CDS 100% 15.000 10.500 N ATE1 n/a
4 TRCN0000034671 GATGACATCAAAGAGAGTTTA pLKO.1 515 CDS 100% 13.200 9.240 N ATE1 n/a
5 TRCN0000435990 GGATATACAGTGTGATCTTAA pLKO_005 484 CDS 100% 13.200 9.240 N ATE1 n/a
6 TRCN0000034670 GTCAGTATAGACCTTCTGATT pLKO.1 1341 CDS 100% 4.950 3.465 N ATE1 n/a
7 TRCN0000034672 CCTGAGACATATGTTTGGGTA pLKO.1 1370 CDS 100% 0.000 0.000 N ATE1 n/a
8 TRCN0000424642 CATCATGCCTTACGGTGTTTA pLKO_005 1516 CDS 100% 13.200 7.920 N ATE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007041.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.