Transcript: Human NM_007055.4

Homo sapiens RNA polymerase III subunit A (POLR3A), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
POLR3A (11128)
Length:
6610
CDS:
109..4281

Additional Resources:

NCBI RefSeq record:
NM_007055.4
NBCI Gene record:
POLR3A (11128)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007055.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296709 AGCCGGAAAGCCGTCTGATTT pLKO_005 837 CDS 100% 13.200 18.480 N POLR3A n/a
2 TRCN0000053041 CGGACAACGATCATCAATGAA pLKO.1 3898 CDS 100% 5.625 7.875 N POLR3A n/a
3 TRCN0000053042 GCATCAATGATAACGGCACAA pLKO.1 3071 CDS 100% 4.050 5.670 N POLR3A n/a
4 TRCN0000290610 GCATCAATGATAACGGCACAA pLKO_005 3071 CDS 100% 4.050 5.670 N POLR3A n/a
5 TRCN0000053039 GCGATATTATCCAGTTCATTT pLKO.1 2792 CDS 100% 13.200 10.560 N POLR3A n/a
6 TRCN0000174152 GCGATATTATCCAGTTCATTT pLKO.1 2792 CDS 100% 13.200 10.560 N POLR3A n/a
7 TRCN0000290544 GCGATATTATCCAGTTCATTT pLKO_005 2792 CDS 100% 13.200 10.560 N POLR3A n/a
8 TRCN0000238262 AGGATGACGACGCGGATTATG pLKO_005 3380 CDS 100% 13.200 9.240 N Polr3a n/a
9 TRCN0000053038 GCTGCACAAATTGAGCATTAT pLKO.1 1509 CDS 100% 13.200 9.240 N POLR3A n/a
10 TRCN0000296708 TTGCTTGAAACCTAATCTATA pLKO_005 4516 3UTR 100% 13.200 9.240 N POLR3A n/a
11 TRCN0000053040 CCAATGAAGATGATCTGACAA pLKO.1 929 CDS 100% 4.950 3.465 N POLR3A n/a
12 TRCN0000290545 CCAATGAAGATGATCTGACAA pLKO_005 929 CDS 100% 4.950 3.465 N POLR3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007055.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.