Transcript: Human NM_007064.5

Homo sapiens kalirin RhoGEF kinase (KALRN), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
KALRN (8997)
Length:
10889
CDS:
165..4034

Additional Resources:

NCBI RefSeq record:
NM_007064.5
NBCI Gene record:
KALRN (8997)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146234 AAGCAGAAGAAAGTTCGCGA pXPR_003 TGG 290 7% 2 0.5818 KALRN KALRN 77637
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007064.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196681 GTTGCACATTTGGACATAAAG pLKO.1 3468 CDS 100% 13.200 18.480 N KALRN n/a
2 TRCN0000001427 GCACAATTAGATGACAAGTTT pLKO.1 4643 3UTR 100% 5.625 4.500 N KALRN n/a
3 TRCN0000001428 GCAAAGATGTGGCTGTGAAAT pLKO.1 3193 CDS 100% 13.200 9.240 N KALRN n/a
4 TRCN0000196857 GTGATGATCTTGACCCTAATA pLKO.1 2419 CDS 100% 13.200 9.240 N KALRN n/a
5 TRCN0000001431 CAACGTATGCAGGGTGGATTT pLKO.1 3743 CDS 100% 10.800 7.560 N KALRN n/a
6 TRCN0000001430 CAAAGATTACTATGCACTGAA pLKO.1 2060 CDS 100% 4.950 3.465 N KALRN n/a
7 TRCN0000001429 GTGGAGTTAATGTGCCTTGTT pLKO.1 1344 CDS 100% 4.950 3.465 N KALRN n/a
8 TRCN0000026869 GCCACCATTTCTTGGAAGGAA pLKO.1 3087 CDS 100% 3.000 2.100 N LOC385625 n/a
9 TRCN0000195291 CTGATAGTTCTCTGAACTAAA pLKO.1 5239 3UTR 100% 1.320 0.924 N KALRN n/a
10 TRCN0000195470 CCAATGTCAAGAGCTACATTG pLKO.1 3988 CDS 100% 1.080 0.756 N KALRN n/a
11 TRCN0000024368 GTTCTGACATATGTCATGCTT pLKO.1 3675 CDS 100% 0.000 0.000 N Kalrn n/a
12 TRCN0000026939 CCACATCCTACATCCTGATTT pLKO.1 3322 CDS 100% 13.200 9.240 N LOC385625 n/a
13 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 6335 3UTR 100% 4.950 2.475 Y ORAI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007064.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.