Transcript: Human NM_007084.4

Homo sapiens SRY-box transcription factor 21 (SOX21), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
SOX21 (11166)
Length:
2924
CDS:
497..1327

Additional Resources:

NCBI RefSeq record:
NM_007084.4
NBCI Gene record:
SOX21 (11166)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007084.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015417 GTACGCGTCGTCGCTGGGCTA pLKO.1 1066 CDS 100% 0.000 0.000 N SOX21 n/a
2 TRCN0000015413 GCCTCCCTGTTTGTACTATTT pLKO.1 1885 3UTR 100% 13.200 10.560 N SOX21 n/a
3 TRCN0000432918 ATGGCAGAGATCTCGTCGTCC pLKO_005 1031 CDS 100% 0.720 0.576 N SOX21 n/a
4 TRCN0000420797 ACGGAGGTGGAGGAGTAACTT pLKO_005 1645 3UTR 100% 5.625 3.938 N SOX21 n/a
5 TRCN0000015416 GCTACATGATCCCGTGCAACT pLKO.1 1194 CDS 100% 4.050 2.835 N SOX21 n/a
6 TRCN0000015414 CAAGAAGGACAAGTTCGCCTT pLKO.1 757 CDS 100% 2.160 1.512 N SOX21 n/a
7 TRCN0000015415 GCCGAGTGGAAACTGCTCACA pLKO.1 626 CDS 100% 0.880 0.616 N SOX21 n/a
8 TRCN0000085983 CCGGTTTGTATGTACATAGAT pLKO.1 1427 3UTR 100% 5.625 7.875 N Sox21 n/a
9 TRCN0000015931 GCTGCTCAAGAAGGACAAGTA pLKO.1 751 CDS 100% 4.950 2.475 Y SOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007084.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.