Transcript: Human NM_007108.4

Homo sapiens elongin B (ELOB), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ELOB (6923)
Length:
974
CDS:
42..398

Additional Resources:

NCBI RefSeq record:
NM_007108.4
NBCI Gene record:
ELOB (6923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007108.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412251 TTCCGGGCAGATGACACCTTT pLKO_005 276 CDS 100% 4.950 6.930 N ELOB n/a
2 TRCN0000011096 CGAACTGAAGCGCATCGTCGA pLKO.1 116 CDS 100% 0.720 1.008 N ELOB n/a
3 TRCN0000053051 CCAACTCTTGGATGATGGCAA pLKO.1 185 CDS 100% 2.640 2.112 N ELOBP2 n/a
4 TRCN0000428607 AGAGCTGCCCGATGTGATGAA pLKO_005 332 CDS 100% 4.950 3.465 N ELOB n/a
5 TRCN0000423815 CAGCACGGTGTTCGAACTGAA pLKO_005 104 CDS 100% 4.950 3.465 N ELOB n/a
6 TRCN0000423802 GAAGCAGTGCCAATGAACAAG pLKO_005 367 CDS 100% 4.950 3.465 N ELOB n/a
7 TRCN0000426023 GACGATGGCCAAGAGCAGAAA pLKO_005 802 3UTR 100% 4.950 3.465 N ELOB n/a
8 TRCN0000421879 ATGAACAAGCCGTGCAGTGAG pLKO_005 379 CDS 100% 4.050 2.835 N ELOB n/a
9 TRCN0000427376 CAAGCCATTGTTAGCAGCTAG pLKO_005 632 3UTR 100% 4.050 2.835 N ELOB n/a
10 TRCN0000007662 GCAGCGGCTGTACAAGGATGA pLKO.1 164 CDS 100% 1.350 0.945 N ELOB n/a
11 TRCN0000007661 CTCTTGGATGATGGCAAGACA pLKO.1 189 CDS 100% 0.300 0.210 N ELOB n/a
12 TRCN0000011097 ACCAGTCAAACAGCACGGCCA pLKO.1 228 CDS 100% 0.180 0.126 N ELOB n/a
13 TRCN0000011098 CGGACGCCAAGGAGTCCAGCA pLKO.1 88 CDS 100% 0.000 0.000 N ELOB n/a
14 TRCN0000426561 ACAAGGATGACCAACTCTTGG pLKO_005 175 CDS 100% 4.050 2.430 N ELOB n/a
15 TRCN0000339912 GCCACAAGACCACCATCTTTA pLKO_005 67 CDS 100% 13.200 9.240 N Elob n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007108.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.