Transcript: Human NM_007123.5

Homo sapiens usherin (USH2A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
USH2A (7399)
Length:
6332
CDS:
388..5028

Additional Resources:

NCBI RefSeq record:
NM_007123.5
NBCI Gene record:
USH2A (7399)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007123.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433528 ATTATCGTCCTGGATACAATA pLKO_005 1772 CDS 100% 13.200 18.480 N USH2A n/a
2 TRCN0000083950 CCAAAGACTAAGTCCACCTAA pLKO.1 4116 CDS 100% 4.950 6.930 N USH2A n/a
3 TRCN0000083952 CCACTGGCTTACTTACAGTTT pLKO.1 3633 CDS 100% 4.950 6.930 N USH2A n/a
4 TRCN0000083948 GCCAGGACTATGGTAAAGCAA pLKO.1 5601 3UTR 100% 3.000 4.200 N USH2A n/a
5 TRCN0000416825 GTCCACAACCAACGGAAATAA pLKO_005 1559 CDS 100% 15.000 10.500 N USH2A n/a
6 TRCN0000421904 TAATCAAGGAGTGACTATTTC pLKO_005 1482 CDS 100% 13.200 9.240 N USH2A n/a
7 TRCN0000083951 GCCACGCAAATAAGGTTTCAT pLKO.1 1831 CDS 100% 5.625 3.938 N USH2A n/a
8 TRCN0000083949 GCACTTACAAACAGAGAGATT pLKO.1 1222 CDS 100% 4.950 3.465 N USH2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007123.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.