Transcript: Human NM_007202.4

Homo sapiens A-kinase anchoring protein 10 (AKAP10), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
AKAP10 (11216)
Length:
4063
CDS:
150..2138

Additional Resources:

NCBI RefSeq record:
NM_007202.4
NBCI Gene record:
AKAP10 (11216)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007202.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420987 CAACAACTTGGTCGCGAATAA pLKO_005 637 CDS 100% 13.200 18.480 N AKAP10 n/a
2 TRCN0000429482 TCGGTTCGAGGAGATGAATTT pLKO_005 1680 CDS 100% 13.200 18.480 N AKAP10 n/a
3 TRCN0000433231 TCTTTATATCAACGGACATAT pLKO_005 1875 CDS 100% 13.200 18.480 N AKAP10 n/a
4 TRCN0000037974 GCATGAAACTACAGCGTCTTT pLKO.1 722 CDS 100% 4.950 6.930 N AKAP10 n/a
5 TRCN0000037978 GCTCAGTATGATCAACCGTTA pLKO.1 2097 CDS 100% 4.050 5.670 N AKAP10 n/a
6 TRCN0000037977 CGACACTATTGTCCTCCCTTA pLKO.1 542 CDS 100% 4.050 3.240 N AKAP10 n/a
7 TRCN0000414612 AGTTACCTGTAGGCATAATTG pLKO_005 2303 3UTR 100% 13.200 9.240 N AKAP10 n/a
8 TRCN0000037975 GCAATGAGAAATGACATCATA pLKO.1 1104 CDS 100% 5.625 3.938 N AKAP10 n/a
9 TRCN0000088597 GCAAGAGCACTTTAGTGAGTT pLKO.1 1205 CDS 100% 4.950 3.465 N Akap10 n/a
10 TRCN0000302433 GCAAGAGCACTTTAGTGAGTT pLKO_005 1205 CDS 100% 4.950 3.465 N Akap10 n/a
11 TRCN0000037976 GCTATGAAGAAATGGGTGCAA pLKO.1 2001 CDS 100% 2.640 1.848 N AKAP10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007202.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.