Transcript: Human NM_007332.3

Homo sapiens transient receptor potential cation channel subfamily A member 1 (TRPA1), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
TRPA1 (8989)
Length:
5191
CDS:
176..3535

Additional Resources:

NCBI RefSeq record:
NM_007332.3
NBCI Gene record:
TRPA1 (8989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007332.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434290 TGCCTTAGATGATAGTCTTAA pLKO_005 3947 3UTR 100% 13.200 18.480 N TRPA1 n/a
2 TRCN0000044799 CGAGACTATTATATCGAGTAT pLKO.1 2129 CDS 100% 4.950 6.930 N TRPA1 n/a
3 TRCN0000428619 CATGAGCTAGCAGACTATTTA pLKO_005 1139 CDS 100% 15.000 12.000 N TRPA1 n/a
4 TRCN0000417945 ATGATGAATTTAGGATCTTAC pLKO_005 2333 CDS 100% 10.800 7.560 N TRPA1 n/a
5 TRCN0000044798 CCAGGCAATAAATGTCCAATT pLKO.1 2024 CDS 100% 10.800 7.560 N TRPA1 n/a
6 TRCN0000044801 GCAATGTTCTTGAATGGATTA pLKO.1 2586 CDS 100% 10.800 7.560 N TRPA1 n/a
7 TRCN0000044802 CCACAAATAATAGCGAAGCAT pLKO.1 696 CDS 100% 3.000 2.100 N TRPA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007332.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.