Transcript: Human NM_007365.3

Homo sapiens peptidyl arginine deiminase 2 (PADI2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PADI2 (11240)
Length:
4361
CDS:
81..2078

Additional Resources:

NCBI RefSeq record:
NM_007365.3
NBCI Gene record:
PADI2 (11240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007365.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423015 TCTCTAATCTGACACTGAATG pLKO_005 2394 3UTR 100% 10.800 15.120 N PADI2 n/a
2 TRCN0000051444 CGGATACGAGATAGTTCTGTA pLKO.1 668 CDS 100% 4.950 6.930 N PADI2 n/a
3 TRCN0000051443 GCACCTTCATCGACGACATTT pLKO.1 1966 CDS 100% 13.200 9.240 N PADI2 n/a
4 TRCN0000051447 GTGTGCTGCATGAAGGATAAT pLKO.1 1011 CDS 100% 13.200 9.240 N PADI2 n/a
5 TRCN0000422076 ACACCGTGATATTCCGGATTG pLKO_005 943 CDS 100% 6.000 4.200 N PADI2 n/a
6 TRCN0000425880 GTTTGCCTCCTTCGCTTAGTT pLKO_005 2097 3UTR 100% 5.625 3.938 N PADI2 n/a
7 TRCN0000051445 GTCAACTACTATGACGAGGAA pLKO.1 363 CDS 100% 2.640 1.848 N PADI2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007365.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.