Transcript: Human NM_007372.3

Homo sapiens DEAD-box helicase 42 (DDX42), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
DDX42 (11325)
Length:
4032
CDS:
276..3092

Additional Resources:

NCBI RefSeq record:
NM_007372.3
NBCI Gene record:
DDX42 (11325)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_007372.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218485 AGATTCTAGCAACGTTGATTT pLKO_005 518 CDS 100% 13.200 18.480 N DDX42 n/a
2 TRCN0000229807 CTTCGATCAGTGGCCGTATAT pLKO_005 1338 CDS 100% 13.200 18.480 N DDX42 n/a
3 TRCN0000229808 TGCTGAAGAGCTAGCGAATAA pLKO_005 1805 CDS 100% 13.200 18.480 N DDX42 n/a
4 TRCN0000051028 CGACTGATAGATCATGTGAAA pLKO.1 1431 CDS 100% 4.950 3.960 N DDX42 n/a
5 TRCN0000104032 GCCCATGTTGATTCATATAAT pLKO.1 1202 CDS 100% 15.000 10.500 N Ddx42 n/a
6 TRCN0000309017 GCCCATGTTGATTCATATAAT pLKO_005 1202 CDS 100% 15.000 10.500 N Ddx42 n/a
7 TRCN0000229809 TTCGGAAATCTCGATTCAAAG pLKO_005 2188 CDS 100% 10.800 7.560 N DDX42 n/a
8 TRCN0000051032 CCAATCTTCAAAGAGTCTCTT pLKO.1 1462 CDS 100% 4.950 3.465 N DDX42 n/a
9 TRCN0000051030 CGGGCCAACTTTGATGAAGAA pLKO.1 471 CDS 100% 4.950 3.465 N DDX42 n/a
10 TRCN0000051029 GCAATGCAGAATGCCTGGTTT pLKO.1 2169 CDS 100% 4.950 3.465 N DDX42 n/a
11 TRCN0000051031 CCATGCAGAATGTAAGCGGTT pLKO.1 1301 CDS 100% 2.160 1.512 N DDX42 n/a
12 TRCN0000229810 GGATGTGCTAAAGCGTGAAAT pLKO_005 3096 3UTR 100% 13.200 7.920 N DDX42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007372.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.