Transcript: Mouse NM_007376.4

Mus musculus pregnancy zone protein (Pzp), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Pzp (11287)
Length:
4681
CDS:
57..4544

Additional Resources:

NCBI RefSeq record:
NM_007376.4
NBCI Gene record:
Pzp (11287)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007376.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079963 CCCGGAAATTACGTCACCAAA pLKO.1 4035 CDS 100% 4.950 6.930 N Pzp n/a
2 TRCN0000079964 CGGATACACTACCTCTTGAAT pLKO.1 1482 CDS 100% 5.625 3.938 N Pzp n/a
3 TRCN0000079966 CAAACGTACAACACACTGTTA pLKO.1 2832 CDS 100% 4.950 3.465 N Pzp n/a
4 TRCN0000079965 GCTCTGGGTATCTACAAGGTT pLKO.1 645 CDS 100% 3.000 2.100 N Pzp n/a
5 TRCN0000079967 GTACCTTCAGACATCTCTAAA pLKO.1 4076 CDS 100% 0.000 0.000 N Pzp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007376.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.