Transcript: Mouse NM_007398.4

Mus musculus adenosine deaminase (Ada), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ada (11486)
Length:
1701
CDS:
149..1207

Additional Resources:

NCBI RefSeq record:
NM_007398.4
NBCI Gene record:
Ada (11486)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007398.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119773 GCGGTTGTTCGCTTCAAGAAT pLKO.1 983 CDS 100% 5.625 7.875 N Ada n/a
2 TRCN0000306785 GCGGTTGTTCGCTTCAAGAAT pLKO_005 983 CDS 100% 5.625 7.875 N Ada n/a
3 TRCN0000295645 AGCCTATGAGGGCGCAGTAAA pLKO_005 745 CDS 100% 13.200 9.240 N Ada n/a
4 TRCN0000295593 AGCCTCATCCTGTGGATAAAG pLKO_005 1260 3UTR 100% 13.200 9.240 N Ada n/a
5 TRCN0000119774 CAAGCCAGAAACCATCTTATA pLKO.1 214 CDS 100% 13.200 9.240 N Ada n/a
6 TRCN0000298430 CAAGCCAGAAACCATCTTATA pLKO_005 214 CDS 100% 13.200 9.240 N Ada n/a
7 TRCN0000119776 CGAGGATGAAGCTCTCTACAA pLKO.1 877 CDS 100% 4.950 3.465 N Ada n/a
8 TRCN0000288385 CGAGGATGAAGCTCTCTACAA pLKO_005 877 CDS 100% 4.950 3.465 N Ada n/a
9 TRCN0000119775 GACTACTACATGCCTGTGATT pLKO.1 344 CDS 100% 4.950 3.465 N Ada n/a
10 TRCN0000119772 GCTGGCTAGGATGCTAAGAAA pLKO.1 1493 3UTR 100% 5.625 3.375 N Ada n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007398.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.