Transcript: Mouse NM_007436.2

Mus musculus aldehyde dehydrogenase family 3, subfamily A1 (Aldh3a1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Aldh3a1 (11670)
Length:
1729
CDS:
178..1539

Additional Resources:

NCBI RefSeq record:
NM_007436.2
NBCI Gene record:
Aldh3a1 (11670)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438676 CACTTCCAGCGGGTCATAAAT pLKO_005 1045 CDS 100% 15.000 21.000 N Aldh3a1 n/a
2 TRCN0000417938 AGCTTGGATGAGGCCATTAAA pLKO_005 1216 CDS 100% 15.000 10.500 N Aldh3a1 n/a
3 TRCN0000042079 CCCTCCATTCAGAATGAAATT pLKO.1 937 CDS 100% 13.200 9.240 N Aldh3a1 n/a
4 TRCN0000425487 GGTGCTTGGAACTACCCATTC pLKO_005 511 CDS 100% 6.000 4.200 N Aldh3a1 n/a
5 TRCN0000042081 GCGGAATGAAGAAGCTAACAA pLKO.1 1476 CDS 100% 5.625 3.938 N Aldh3a1 n/a
6 TRCN0000042078 GCTGTCCTGTCCTTGAAGAAT pLKO.1 1572 3UTR 100% 5.625 3.938 N Aldh3a1 n/a
7 TRCN0000042082 GCGCATGATCAACGAGAACTT pLKO.1 279 CDS 100% 4.950 3.465 N Aldh3a1 n/a
8 TRCN0000042080 CCTCAGTATATGGACAAGGAT pLKO.1 640 CDS 100% 3.000 2.100 N Aldh3a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.