Transcript: Mouse NM_007479.3

Mus musculus ADP-ribosylation factor 4 (Arf4), mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Arf4 (11843)
Length:
2042
CDS:
224..766

Additional Resources:

NCBI RefSeq record:
NM_007479.3
NBCI Gene record:
Arf4 (11843)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007479.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100243 GTAGATAGCAATGATCGTGAA pLKO.1 497 CDS 100% 4.050 5.670 N Arf4 n/a
2 TRCN0000325089 GTAGATAGCAATGATCGTGAA pLKO_005 497 CDS 100% 4.050 5.670 N Arf4 n/a
3 TRCN0000305957 CGTTAAATGAAGCTGGATATC pLKO_005 761 CDS 100% 10.800 8.640 N Arf4 n/a
4 TRCN0000100242 CCACTTGTGCTACACAAGGAA pLKO.1 693 CDS 100% 0.300 0.240 N Arf4 n/a
5 TRCN0000305955 AGAATACCCAGGGTCTCATTT pLKO_005 471 CDS 100% 13.200 9.240 N Arf4 n/a
6 TRCN0000311433 AGTTATTCCCTTGATACTTTA pLKO_005 1098 3UTR 100% 13.200 9.240 N Arf4 n/a
7 TRCN0000305956 GATGTTGGTGGTCAAGATAAA pLKO_005 422 CDS 100% 13.200 9.240 N Arf4 n/a
8 TRCN0000382476 GGCAGAAATTACAGCGTTTAA pLKO_005 875 3UTR 100% 13.200 9.240 N Arf4 n/a
9 TRCN0000380167 TATGCTTCCCTTGAACCTAAA pLKO_005 1001 3UTR 100% 10.800 7.560 N Arf4 n/a
10 TRCN0000100241 GCTGTCAAATGAACTTTCAAA pLKO.1 739 CDS 100% 5.625 3.938 N Arf4 n/a
11 TRCN0000100240 GCCCAGTATATGATAGTTCTA pLKO.1 1478 3UTR 100% 4.950 3.465 N Arf4 n/a
12 TRCN0000100244 TCTCCGAAACAGAACATGGTA pLKO.1 664 CDS 100% 3.000 2.100 N Arf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007479.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.