Transcript: Mouse NM_007483.2

Mus musculus ras homolog family member B (Rhob), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Rhob (11852)
Length:
2264
CDS:
354..944

Additional Resources:

NCBI RefSeq record:
NM_007483.2
NBCI Gene record:
Rhob (11852)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007483.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077537 CGACGTCATCCTTATGTGCTT pLKO.1 584 CDS 100% 2.640 3.696 N Rhob n/a
2 TRCN0000287354 CGACGTCATCCTTATGTGCTT pLKO_005 584 CDS 100% 2.640 3.696 N Rhob n/a
3 TRCN0000077536 CAGGAGGACTACGATCGTTTA pLKO.1 540 CDS 100% 10.800 7.560 N Rhob n/a
4 TRCN0000294874 CAACTGCTGCAAGGTGCTATG pLKO_005 923 CDS 100% 6.000 4.200 N Rhob n/a
5 TRCN0000331154 CAACTGCTGCAAGGTGCTATG pLKO_005 923 CDS 100% 6.000 4.200 N RHOB n/a
6 TRCN0000077535 CCCACCGTGTTCGAGAACTAT pLKO.1 459 CDS 100% 5.625 3.938 N Rhob n/a
7 TRCN0000077533 CCTGTCCTACAAATGAACATT pLKO.1 1711 3UTR 100% 5.625 3.938 N Rhob n/a
8 TRCN0000287355 CCTGTCCTACAAATGAACATT pLKO_005 1711 3UTR 100% 5.625 3.938 N Rhob n/a
9 TRCN0000047849 CCTGCTGATCGTGTTCAGTAA pLKO.1 413 CDS 100% 4.950 3.465 N RHOB n/a
10 TRCN0000291562 CCTGCTGATCGTGTTCAGTAA pLKO_005 413 CDS 100% 4.950 3.465 N RHOB n/a
11 TRCN0000294849 GCGCATCCAAGCCTATGACTA pLKO_005 800 CDS 100% 4.950 3.465 N Rhob n/a
12 TRCN0000294848 GAAGTGGGTGCCCGAGGTAAA pLKO_005 644 CDS 100% 3.600 2.520 N Rhob n/a
13 TRCN0000077534 CGTGTTCAGTAAAGACGAATT pLKO.1 422 CDS 100% 0.000 0.000 N Rhob n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007483.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.