Transcript: Mouse NM_007503.3

Mus musculus FXYD domain-containing ion transport regulator 2 (Fxyd2), transcript variant a, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Mus musculus (mouse)
Gene:
Fxyd2 (11936)
Length:
569
CDS:
54..266

Additional Resources:

NCBI RefSeq record:
NM_007503.3
NBCI Gene record:
Fxyd2 (11936)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007503.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079304 CCCTTCGAGTACGACTATGAA pLKO.1 117 CDS 100% 5.625 7.875 N Fxyd2 n/a
2 TRCN0000079307 CGACTATGAAACCGTCCGCAA pLKO.1 128 CDS 100% 2.160 3.024 N Fxyd2 n/a
3 TRCN0000432603 CGCAAAGGAGGCCTGATCTTC pLKO_005 144 CDS 100% 1.650 1.320 N Fxyd2 n/a
4 TRCN0000419363 AGATGAACTGTGACAGAAGAG pLKO_005 254 CDS 100% 4.050 2.835 N Fxyd2 n/a
5 TRCN0000079305 GACAGAGAATCCCTTCGAGTA pLKO.1 107 CDS 100% 4.050 2.835 N Fxyd2 n/a
6 TRCN0000426904 TCGTGGGCCTCCTCATCATTC pLKO_005 181 CDS 100% 3.600 2.520 N Fxyd2 n/a
7 TRCN0000079306 GTAAGAAACATAGGCAGGTCA pLKO.1 229 CDS 100% 2.640 1.848 N Fxyd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007503.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.