Transcript: Mouse NM_007553.3

Mus musculus bone morphogenetic protein 2 (Bmp2), mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Bmp2 (12156)
Length:
3566
CDS:
1201..2385

Additional Resources:

NCBI RefSeq record:
NM_007553.3
NBCI Gene record:
Bmp2 (12156)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025878 CCAGCACCGAATTAATATTTA pLKO.1 1695 CDS 100% 15.000 21.000 N Bmp2 n/a
2 TRCN0000362819 CGTTAGCACAGCAAGAATAAA pLKO_005 2380 CDS 100% 15.000 21.000 N Bmp2 n/a
3 TRCN0000231207 GGCGCTTCTTCTTCAATTTAA pLKO_005 1586 CDS 100% 15.000 21.000 N Bmp2 n/a
4 TRCN0000231206 GAAGACGTCCTCAGCGAATTT pLKO_005 1336 CDS 100% 13.200 18.480 N Bmp2 n/a
5 TRCN0000231210 GATCTGGCCAAAGTACTAAAT pLKO_005 3209 3UTR 100% 13.200 18.480 N Bmp2 n/a
6 TRCN0000025939 CCTCCGGGCTATCATGCCTTT pLKO.1 2143 CDS 100% 1.350 1.890 N Bmp2 n/a
7 TRCN0000362890 GTATAATGGTCAGAGTTATTT pLKO_005 2664 3UTR 100% 15.000 10.500 N Bmp2 n/a
8 TRCN0000231208 TAGTTTCCAGCACCGAATTAA pLKO_005 1689 CDS 100% 15.000 10.500 N Bmp2 n/a
9 TRCN0000025949 CCAAGAGACATGTGAGGATTA pLKO.1 1913 CDS 100% 10.800 7.560 N Bmp2 n/a
10 TRCN0000231209 GTGAGGATTAGCAGGTCTTTG pLKO_005 1924 CDS 100% 10.800 7.560 N Bmp2 n/a
11 TRCN0000362820 TTTCCTGTGACCAGACTATTG pLKO_005 1750 CDS 100% 10.800 7.560 N Bmp2 n/a
12 TRCN0000025877 CGGCGCTTCTTCTTCAATTTA pLKO.1 1585 CDS 100% 15.000 9.000 N Bmp2 n/a
13 TRCN0000025923 GCTCAGCATGTTTGGCCTGAA pLKO.1 1368 CDS 100% 4.050 2.430 N Bmp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.