Transcript: Mouse NM_007567.2

Mus musculus bassoon (Bsn), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Bsn (12217)
Length:
15953
CDS:
126..11954

Additional Resources:

NCBI RefSeq record:
NM_007567.2
NBCI Gene record:
Bsn (12217)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111735 CCCACCAATTACGAGGTGATT pLKO.1 9624 CDS 100% 4.950 6.930 N Bsn n/a
2 TRCN0000111738 CCTAACGCTTTCCTCTGACAT pLKO.1 4670 CDS 100% 4.950 3.465 N Bsn n/a
3 TRCN0000111736 CCTTTGGTTATCAACCTCAAT pLKO.1 5271 CDS 100% 4.950 3.465 N Bsn n/a
4 TRCN0000111739 GCCAGAGAACAACTTCTCCAA pLKO.1 379 CDS 100% 0.264 0.185 N Bsn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007567.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.