Transcript: Mouse NM_007568.5

Mus musculus betacellulin, epidermal growth factor family member (Btc), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Btc (12223)
Length:
2876
CDS:
274..807

Additional Resources:

NCBI RefSeq record:
NM_007568.5
NBCI Gene record:
Btc (12223)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007568.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089485 CCTCTTCGGAAACATCGTAAA pLKO.1 703 CDS 100% 10.800 15.120 N Btc n/a
2 TRCN0000318236 CCTCTTCGGAAACATCGTAAA pLKO_005 703 CDS 100% 10.800 15.120 N Btc n/a
3 TRCN0000089484 CCCATAAGTGAAGATATTCAA pLKO.1 769 CDS 100% 5.625 7.875 N Btc n/a
4 TRCN0000318313 CCCATAAGTGAAGATATTCAA pLKO_005 769 CDS 100% 5.625 7.875 N Btc n/a
5 TRCN0000089483 CCGGGTTTATACACTTATCAT pLKO.1 1333 3UTR 100% 5.625 7.875 N Btc n/a
6 TRCN0000318314 CCGGGTTTATACACTTATCAT pLKO_005 1333 3UTR 100% 5.625 7.875 N Btc n/a
7 TRCN0000089486 GCAGTACAAGCATTACTGCAT pLKO.1 486 CDS 100% 0.264 0.211 N Btc n/a
8 TRCN0000089487 TGGTAGCAGATGGGAACACAA pLKO.1 359 CDS 100% 4.950 3.465 N Btc n/a
9 TRCN0000318311 TGGTAGCAGATGGGAACACAA pLKO_005 359 CDS 100% 4.950 3.465 N Btc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007568.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.