Transcript: Mouse NM_007619.2

Mus musculus Casitas B-lineage lymphoma (Cbl), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cbl (12402)
Length:
5083
CDS:
159..2900

Additional Resources:

NCBI RefSeq record:
NM_007619.2
NBCI Gene record:
Cbl (12402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007619.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381278 GACACTTTCCGGATTACTAAA pLKO_005 681 CDS 100% 13.200 18.480 N Cbl n/a
2 TRCN0000042568 CGCACTGTCTTGTCAAGATAT pLKO.1 438 CDS 100% 13.200 10.560 N Cbl n/a
3 TRCN0000380139 AGGCGAAACCTGACCAAATTA pLKO_005 594 CDS 100% 15.000 10.500 N Cbl n/a
4 TRCN0000380089 GCTGTGCTGTGGCCCTAATTA pLKO_005 3199 3UTR 100% 15.000 10.500 N Cbl n/a
5 TRCN0000381199 ACCAACTCCTCAAGATCATAT pLKO_005 1214 CDS 100% 13.200 9.240 N Cbl n/a
6 TRCN0000295906 TGATCTGACCTGCAATGATTA pLKO_005 836 CDS 100% 13.200 9.240 N CBL n/a
7 TRCN0000380202 TGATCTGACCTGCAATGATTA pLKO_005 836 CDS 100% 13.200 9.240 N Cbl n/a
8 TRCN0000042569 CCTCGGAGAATCAACTCAGAA pLKO.1 2655 CDS 100% 4.950 3.465 N Cbl n/a
9 TRCN0000042571 GCAGACTATCAGCCTCTTCAA pLKO.1 533 CDS 100% 4.950 3.465 N Cbl n/a
10 TRCN0000042570 CCCACACAATAAACCGCTCTT pLKO.1 1106 CDS 100% 4.050 2.835 N Cbl n/a
11 TRCN0000042572 CCTGACCAAATTATCCCTGAT pLKO.1 602 CDS 100% 4.050 2.835 N Cbl n/a
12 TRCN0000039725 CCCTTCATAAAGACAAACCAT pLKO.1 1729 CDS 100% 3.000 2.100 N CBL n/a
13 TRCN0000010310 GACAAGAAGATGGTGGAGAAG pLKO.1 306 CDS 100% 4.050 2.430 N CBL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007619.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.