Transcript: Mouse NM_007622.3

Mus musculus chromobox 1 (Cbx1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cbx1 (12412)
Length:
1274
CDS:
256..813

Additional Resources:

NCBI RefSeq record:
NM_007622.3
NBCI Gene record:
Cbx1 (12412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007622.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062224 CCCACAGGTTGTCATATCCTT pLKO.1 723 CDS 100% 3.000 2.400 N CBX1 n/a
2 TRCN0000290222 CCCACAGGTTGTCATATCCTT pLKO_005 723 CDS 100% 3.000 2.400 N CBX1 n/a
3 TRCN0000294884 AGAATTAGCCCTGTCTTCTTC pLKO_005 806 CDS 100% 4.950 3.465 N Cbx1 n/a
4 TRCN0000071029 TCTTCTAAAGTGGAAGGGTTT pLKO.1 369 CDS 100% 4.050 2.835 N Cbx1 n/a
5 TRCN0000298344 TCTTCTAAAGTGGAAGGGTTT pLKO_005 369 CDS 100% 4.050 2.835 N Cbx1 n/a
6 TRCN0000071030 CAGAGCGGATTATTGGAGCTA pLKO.1 611 CDS 100% 2.640 1.848 N Cbx1 n/a
7 TRCN0000298347 CAGAGCGGATTATTGGAGCTA pLKO_005 611 CDS 100% 2.640 1.848 N Cbx1 n/a
8 TRCN0000071032 GAGGTACTAGAAGAAGAGGAA pLKO.1 289 CDS 100% 2.640 1.848 N Cbx1 n/a
9 TRCN0000071031 GAGTTTCTACAGTCACAGAAA pLKO.1 451 CDS 100% 0.495 0.347 N Cbx1 n/a
10 TRCN0000287389 GAGTTTCTACAGTCACAGAAA pLKO_005 451 CDS 100% 0.495 0.347 N Cbx1 n/a
11 TRCN0000071028 CCTGACCTTATTGCTGAGTTT pLKO.1 436 CDS 100% 4.950 2.970 N Cbx1 n/a
12 TRCN0000298343 CCTGACCTTATTGCTGAGTTT pLKO_005 436 CDS 100% 4.950 2.970 N Cbx1 n/a
13 TRCN0000062225 GAAGAGGAATATGTGGTGGAA pLKO.1 307 CDS 100% 2.640 1.584 N CBX1 n/a
14 TRCN0000290220 GAAGAGGAATATGTGGTGGAA pLKO_005 307 CDS 100% 2.640 1.584 N CBX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007622.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.