Transcript: Mouse NM_007641.5

Mus musculus membrane-spanning 4-domains, subfamily A, member 1 (Ms4a1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ms4a1 (12482)
Length:
2057
CDS:
120..995

Additional Resources:

NCBI RefSeq record:
NM_007641.5
NBCI Gene record:
Ms4a1 (12482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007641.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100158 GTGTACCAGATCCAAATCTAA pLKO.1 758 CDS 100% 5.625 4.500 N Ms4a1 n/a
2 TRCN0000100157 ACGACTGTGAACCATCTAATT pLKO.1 595 CDS 100% 13.200 9.240 N Ms4a1 n/a
3 TRCN0000100155 CCACAATCTATTCTCCATATT pLKO.1 1070 3UTR 100% 13.200 9.240 N Ms4a1 n/a
4 TRCN0000100159 TGGAGTATCTTCCCAACCAAA pLKO.1 851 CDS 100% 4.950 3.465 N Ms4a1 n/a
5 TRCN0000100156 GCTGCCATTTCTGGAATAATT pLKO.1 477 CDS 100% 15.000 7.500 Y Ms4a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007641.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.