Transcript: Mouse NM_007642.4

Mus musculus CD28 antigen (Cd28), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cd28 (12487)
Length:
4317
CDS:
87..743

Additional Resources:

NCBI RefSeq record:
NM_007642.4
NBCI Gene record:
Cd28 (12487)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007642.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067989 CGTCAATCACACAGATATTTA pLKO.1 398 CDS 100% 15.000 12.000 N Cd28 n/a
2 TRCN0000067992 TCTCAGTTCAAGTAACAGAAA pLKO.1 124 CDS 100% 4.950 3.465 N Cd28 n/a
3 TRCN0000067990 CGACAACGAAACAGTGACGTT pLKO.1 359 CDS 100% 2.640 1.848 N Cd28 n/a
4 TRCN0000067991 CTTTGTGTTATCTGGACAAAT pLKO.1 600 CDS 100% 1.320 0.924 N Cd28 n/a
5 TRCN0000067988 GCCACCATTAACCCAAGTTAA pLKO.1 3839 3UTR 100% 1.320 0.924 N Cd28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007642.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.