Transcript: Mouse NM_007649.4

Mus musculus CD48 antigen (Cd48), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Cd48 (12506)
Length:
1142
CDS:
40..762

Additional Resources:

NCBI RefSeq record:
NM_007649.4
NBCI Gene record:
Cd48 (12506)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007649.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065492 AGGTCATTCAATACCAGATAT pLKO.1 111 CDS 100% 13.200 18.480 N Cd48 n/a
2 TRCN0000065488 GCAGGGTTTATCTTGAAGAAA pLKO.1 284 CDS 100% 5.625 4.500 N Cd48 n/a
3 TRCN0000065490 CCACAGAACAAGTCTACATTT pLKO.1 589 CDS 100% 13.200 9.240 N Cd48 n/a
4 TRCN0000065489 GCCTTCCATAGAAATCAATAA pLKO.1 429 CDS 100% 13.200 9.240 N Cd48 n/a
5 TRCN0000065491 CTGGAGTATGTTGGACTGCAA pLKO.1 692 CDS 100% 2.640 1.848 N Cd48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007649.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.