Transcript: Mouse NM_007686.3

Mus musculus complement component factor i (Cfi), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Cfi (12630)
Length:
2077
CDS:
72..1883

Additional Resources:

NCBI RefSeq record:
NM_007686.3
NBCI Gene record:
Cfi (12630)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007686.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000369978 CCATGGCAGGTGGCAATTAAG pLKO_005 1188 CDS 100% 13.200 18.480 N CFI n/a
2 TRCN0000031552 CCATATCTGTTCCAACCGAAT pLKO.1 1503 CDS 100% 4.050 5.670 N Cfi n/a
3 TRCN0000334627 CCATATCTGTTCCAACCGAAT pLKO_005 1503 CDS 100% 4.050 5.670 N Cfi n/a
4 TRCN0000031553 CCAGACCAATACAAGTGTAAT pLKO.1 903 CDS 100% 13.200 10.560 N Cfi n/a
5 TRCN0000334700 CCAGACCAATACAAGTGTAAT pLKO_005 903 CDS 100% 13.200 10.560 N Cfi n/a
6 TRCN0000031551 CCTTAATTTATGGGAGAACAA pLKO.1 424 CDS 100% 4.950 3.960 N Cfi n/a
7 TRCN0000031550 CGGCTTTATTAGACTGGCTAA pLKO.1 1315 CDS 100% 4.050 2.835 N Cfi n/a
8 TRCN0000334701 CGGCTTTATTAGACTGGCTAA pLKO_005 1315 CDS 100% 4.050 2.835 N Cfi n/a
9 TRCN0000031549 CCTCCTTCTTTCTACATTTAT pLKO.1 1892 3UTR 100% 15.000 9.000 N Cfi n/a
10 TRCN0000334703 CCTCCTTCTTTCTACATTTAT pLKO_005 1892 3UTR 100% 15.000 9.000 N Cfi n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007686.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.