Transcript: Mouse NM_007723.2

Mus musculus cyclic nucleotide gated channel alpha 1 (Cnga1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cnga1 (12788)
Length:
2750
CDS:
266..2320

Additional Resources:

NCBI RefSeq record:
NM_007723.2
NBCI Gene record:
Cnga1 (12788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007723.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068644 CCGATATGTTTGTACGAACAA pLKO.1 879 CDS 100% 4.950 6.930 N Cnga1 n/a
2 TRCN0000068647 GCTGTTAAGGATCTCTCGAAT pLKO.1 1063 CDS 100% 4.950 6.930 N Cnga1 n/a
3 TRCN0000068645 GCTATCAAACAGTACATGAAT pLKO.1 1487 CDS 100% 5.625 3.938 N Cnga1 n/a
4 TRCN0000068646 CCTGACAAACTAAGGGCAGAA pLKO.1 1613 CDS 100% 4.050 2.835 N Cnga1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007723.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.