Transcript: Mouse NM_007737.2

Mus musculus collagen, type V, alpha 2 (Col5a2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Col5a2 (12832)
Length:
6615
CDS:
369..4862

Additional Resources:

NCBI RefSeq record:
NM_007737.2
NBCI Gene record:
Col5a2 (12832)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090828 CCCGCACTTGTGATGATTTAA pLKO.1 4240 CDS 100% 15.000 21.000 N Col5a2 n/a
2 TRCN0000421693 ACCTTATCCTTCAGAATATTT pLKO_005 5005 3UTR 100% 15.000 10.500 N Col5a2 n/a
3 TRCN0000418267 AGGGTACTGTGTCTCAATAAA pLKO_005 422 CDS 100% 15.000 10.500 N Col5a2 n/a
4 TRCN0000090829 CCAGGATTAGTGCCTGTTGTA pLKO.1 714 CDS 100% 4.950 3.465 N Col5a2 n/a
5 TRCN0000083981 CCTGGTCCAAATGGTGAACAA pLKO.1 3831 CDS 100% 4.950 3.465 N COL5A2 n/a
6 TRCN0000090830 GCAAAGAGGAATTGTTGGAAT pLKO.1 3332 CDS 100% 4.950 3.465 N Col5a2 n/a
7 TRCN0000090832 GTTGGATATATGGATGATCAA pLKO.1 4587 CDS 100% 4.950 3.465 N Col5a2 n/a
8 TRCN0000090831 CATGGTATTCAGGGTCCCATT pLKO.1 1824 CDS 100% 4.050 2.835 N Col5a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007737.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.