Transcript: Mouse NM_007757.2

Mus musculus coproporphyrinogen oxidase (Cpox), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Cpox (12892)
Length:
3186
CDS:
221..1552

Additional Resources:

NCBI RefSeq record:
NM_007757.2
NBCI Gene record:
Cpox (12892)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007757.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000076674 CCGTCGTTCATGGGAATCTTT pLKO.1 810 CDS 100% 5.625 7.875 N Cpox n/a
2 TRCN0000326173 CCGTCGTTCATGGGAATCTTT pLKO_005 810 CDS 100% 5.625 7.875 N Cpox n/a
3 TRCN0000076677 TGTGACGACTACTTCTTTATA pLKO.1 1142 CDS 100% 15.000 12.000 N Cpox n/a
4 TRCN0000326099 TGTGACGACTACTTCTTTATA pLKO_005 1142 CDS 100% 15.000 12.000 N Cpox n/a
5 TRCN0000222616 CCCTGGATTCTGATACTTAAA pLKO.1 2517 3UTR 100% 13.200 9.240 N Cpox n/a
6 TRCN0000326101 CCCTGGATTCTGATACTTAAA pLKO_005 2517 3UTR 100% 13.200 9.240 N Cpox n/a
7 TRCN0000076675 CCAGACATCTACCCAAAGTTT pLKO.1 1112 CDS 100% 5.625 3.938 N Cpox n/a
8 TRCN0000076676 GTGGAGTTTAATCTGTTGTAT pLKO.1 1364 CDS 100% 5.625 3.938 N Cpox n/a
9 TRCN0000326100 GTGGAGTTTAATCTGTTGTAT pLKO_005 1364 CDS 100% 5.625 3.938 N Cpox n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007757.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.