Transcript: Mouse NM_007773.4

Mus musculus crystallin, beta B2 (Crybb2), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Crybb2 (12961)
Length:
916
CDS:
197..814

Additional Resources:

NCBI RefSeq record:
NM_007773.4
NBCI Gene record:
Crybb2 (12961)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007773.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008522 GAGCACAAGATCATCTTATAT pLKO.1 512 CDS 100% 15.000 21.000 N Crybb2 n/a
2 TRCN0000011445 GCGAGCAGTTTGTGTTTGAAA pLKO.1 402 CDS 100% 5.625 3.938 N Crybb2 n/a
3 TRCN0000008524 CAACCTGAAGGAGACTGGTAT pLKO.1 313 CDS 100% 4.950 3.465 N Crybb2 n/a
4 TRCN0000008525 CCAACTTTACTGGCAAGAAGA pLKO.1 540 CDS 100% 4.950 3.465 N Crybb2 n/a
5 TRCN0000415179 GAGATTGTAGACGACGATGTG pLKO_005 563 CDS 100% 4.050 2.835 N Crybb2 n/a
6 TRCN0000418882 AGTACCCACGTTGGGACTCCT pLKO_005 429 CDS 100% 0.880 0.616 N Crybb2 n/a
7 TRCN0000008523 CCCATCAAAGTGGACAGCCAA pLKO.1 491 CDS 100% 2.640 1.584 N Crybb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007773.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.