Transcript: Mouse NM_007792.4

Mus musculus cysteine and glycine-rich protein 2 (Csrp2), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Csrp2 (13008)
Length:
889
CDS:
81..662

Additional Resources:

NCBI RefSeq record:
NM_007792.4
NBCI Gene record:
Csrp2 (13008)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007792.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075454 GAAGGCGAAATCTACTGTAAA pLKO.1 564 CDS 100% 13.200 18.480 N Csrp2 n/a
2 TRCN0000315999 GAAGGCGAAATCTACTGTAAA pLKO_005 564 CDS 100% 13.200 18.480 N Csrp2 n/a
3 TRCN0000304355 CCCTTGTTCATGCTCAGTAAT pLKO_005 643 CDS 100% 13.200 9.240 N Csrp2 n/a
4 TRCN0000304356 CCTCACAGGCCTACGACAAAT pLKO_005 369 CDS 100% 13.200 9.240 N Csrp2 n/a
5 TRCN0000075456 CTTCTAAATTTGCCCAGAAAT pLKO.1 397 CDS 100% 13.200 9.240 N Csrp2 n/a
6 TRCN0000075453 GCACGACAGAGAATCTCCATT pLKO.1 680 3UTR 100% 4.950 3.465 N Csrp2 n/a
7 TRCN0000315921 GCACGACAGAGAATCTCCATT pLKO_005 680 3UTR 100% 4.950 3.465 N Csrp2 n/a
8 TRCN0000075457 CACTTCTAAATTTGCCCAGAA pLKO.1 395 CDS 100% 4.050 2.835 N Csrp2 n/a
9 TRCN0000310940 ATGCTGCGGAGAAGATCATTG pLKO_005 460 CDS 100% 10.800 6.480 N Csrp2 n/a
10 TRCN0000075455 CTGCAAATCCTGCTACGGAAA pLKO.1 251 CDS 100% 4.050 2.430 N Csrp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007792.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.